2. Abdoul-Azize S, Dubus
I, Vannier JP. Improvement of dexamethasone sensitivity by chelation of
intracellular Ca2+ in pediatric acute lymphoblastic leukemia cells
through the prosurvival kinase ERK1/2 deactivation. Oncotarget 2017; 8:27339-52.

1. Simon T, Coquerel B, Petit A, Kassim Y, Demange E, Le Cerf D, et al.
Direct effect of bevacizumab on glioblastoma cell lines in vitro.
Neuromolecular Med 2014; 16:752-71.

Supplemental References

 

 

 

 

 

 

 

NucleoSpin® RNA XS-column (Macherey-Nagel, Düren,
Germany) was used to extract total RNA from cells according to the
manufacturer’s instructions. 1 ?g of RNA reverse-transcribed into cDNA using
iScript cDNA synthesis kit (Bio-Rad). qPCR amplification was done using iQ™
SYBR® Green supermix (Bio-Rad) method according to the
manufacturer’s instructions under the Roche LightCycler480 System. Gene expression
was normalized to GAPDH gene. Primers used to evaluate gene expression were as
follows (5′ to 3′): Stim1 forward gcagagttttgccgaattg and reverse
tgaggtgattatggcgagtc; Orai1 forward gagttactccgaggtgatga and reverse
gaccgagttgagattgtgc; Orai2 forward catggattaccgggactg and reverse
cacggggaggaacttgat; Orai3 forward ttgctgaagttgtcctgg and reverse
tcctctagttcctgcttgtag; Trpc1 forward ctggtatgaagggttggaaga and reverse
aaagcaggtgccaatgaac; Trpc3 forward atgacagtgatgcgggaga and reverse
cctcgtcgtaagcgtagaagt; Trpc4 forward tggatgatattaccgtgggt and reverse
cttcaaaatgtccaggagca; Trpc5 forward ctccctctacctggcaactat and reverse
gctcctacaaactcggtgaat; Trpc6 forward tttactggtttgctccatgc and reverse
agaggggtcccactttatcc; Trpc7 forward cgacgacgacttctatgcct and reverse
cgcccactacaaaatcctt; Gapdh forward aacagcgacacccactcctc and reverse ggaggggagattcagtgtggt. 2-??CT referred to the fold-change of the RNA
expression of one sample when compared to the internal control sample.

RNA extraction and RT-qPCR

 

Wound-healing
assay was used to evaluate cells migration. Wounds were generated by scraping a
80% confluent cell monolayer through a pipette tip and gently washed with PBS. Cells were then maintained
in RPMI containing 10% FBS with BAPTA-AM (5 µM) or EGTA (100 µM) for 30 min
then stimulated with or without simvastatin (100 nM) or doxorubicin (1 µM).
Images of wounds were taken immediately and 6 h after wounding. Wound areas
were measured in 5 random fields by Saisam software (Microvision Instruments,
Evry, France) and photographed by Axiovert 135 microscope (Zeiss, Le Pecq,
France) with a Sony DXC-930P video camera. Wound closure was estimated as the percentage
of wound area change.

Cell
migration assay

 

To measure the cellular activity of caspase-3, we used
the method described previously2. For breast cancer cell xenografts,
tissues were rapidly chopped with scissors and lysates were prepared using the
same buffer described before2.

Measurement
of Caspase-3 Activity

 

Phase contrast images were captured using an Axiovert 135 microscope
(Zeiss, Le Pecq, France) with a Sony 3-CCD color video camera (DXC-930P) and
the Saisam software (Microvision Instruments, Evry, France).

Phase
contrast imaging

 

HA hydrogels-containing cells were placed in a 96-well plate and colonies
were grown for 6 days. For
colony quantification, cell colonies were evaluated using MTT method2.
The values of control treatment were considered as 100%.

Cell colonies counting

 

At the end of invasion period, in some experiments, HA
Hydrogels were fixed, followed by rinses, then permeabilized and stained with DAPI
for 1 h 30 at room temperature. After additional three washing, cells colonies
in HA hydrogels were visualized and photographed under Zeiss Axiovert 200M
fluorescence microscope.

Cell colonies fixation and DAPI staining

 

We defined cellular invasiveness as the capacity of
tumor cells to penetrate HA hydrogel to form colonies according to the method
described recently1. The cells were treated with simvastatin (100
nM) or doxorubicin (1 µM) during the HA hydrogel penetration period and the
colonies formation period (Fig. 6D) in the presence or absence of extracellular
Ca2+ chelator (EGTA, 100 µM) or intracellular Ca2+
chelator (BAPTA-AM, 5 µM).

Cells invasiveness and colony formation in HA hydrogels

 

Breast
carcinoma samples were received from the Rouen Henri Becquerel Cancer Center (France)
after approval of the protocols by its Review committee in accordance with the Helsinki
Declaration. All subjects (supplementary Table 1) associated with
this study have signed a written consent for the use of their samples. These
latter were isolated from five donors, ages 40, 47, 50, 51 and 58, and transferred
in ice-cold RPMI 1640 medium to the laboratory at Rouen University within 0.5
to 1 hour. Once at
the laboratory, samples were rapidly chopped with scissors and digested at 37
°C for 3 h
in serum-free low-glucose-DMEM medium containing 200 U / ml collagenase II
(Sigma), 50 U / ml DNase and 5 mM CaCl2. A 100 µm Nylon Mesh Cell
Strainer (BD Falcon, Le Pont de Claix, France) was used for obtaining a
single-cell suspension. Cells were then pelleted by low-speed centrifugation
and cultured in complete low-glucose-DMEM medium as described above.

Human
breast tumor dissociation

 

MDA-MB-231 and MCF-7 cell lines were used in the study
and obtained from the European Collection of Authenticated Cell Cultures
(ECACC, Porton Down, SP4 0JG Salisbury, UK). MDA-MB-231 and MCF-7 cells were
cultured in RPMI 1640 and low-glucose-DMEM medium (Eurobio®, Courtaboeuf,
France), respectively. These were completed with 10% fetal bovine serum (FBS),
2 mM of L-glutamine, 5000 UI/L penicillin and 50 mg/L streptomycin, all from Eurobio®.
Cells were maintained at 37°C in a 5% CO2. The reagents as BAPTA-AM,
U73122, Rhod-2/AM, Fura-2/AM and SKF96365 were purchased from Abcam
Biochemicals (Paris, France). EGTA, Simvastatin, Poly-D-lysine, DAPI, 2-APB and
dimethylsulfoxide were purchased from Sigma Aldrich (St-Quentin Fallavier,
France). Doxorubicin chlorhydrate was purchased from Amersham Pharmacia
Biotech, Inc. (Uppsala, Sweden). Ac-DEVD-AFC substrate, N-Acetyl-L-Cysteine (NAC) was obtained from Enzo
Life Sciences (ELS) AG, Villeurbanne, France. Anti-phospho-Erk1/2, GAPDH
antibody for loading control and the antibody against
cleaved caspase-3 were purchased from Cell Signaling Technology. Stim1 antibody,
TRPC1 antibody, TRPC3 antibody, BIM-phycoerythrin monoclonal antibody IgG1, JC-10 dye, Dihydrorhodamine
123 (DHR 123)  were obtained from Santa
Cruz Biotechnology. The secondary Antibody, Alexa Fluor® 700 conjugate came
from Thermo Fisher Scientific.

Cell lines, antibodies and reagents

 

Supplementary
Materials and Methods