CHAPTER 5CONSTRUCTION OF A TRANSPOSON INSERTION LIBRARY IN L. MONOCYTOGENESABSTRACTL. monocytogenes has imposed significant concerns to food safety and public health due to its ability to respond to environmental stress challenges during food processing and storage.  Having approx. 3000 genes in its genome, this pathogen fine-tunes expression of different subsets of genes to survive and thrive under different environmental conditions. Although transcriptomic and proteomic studies have provided insights into the physiological and regulatory network of L. monocytogenes, these approaches usually need to be complemented by genetic approaches such as gene knockouts. While studying the functions of individual genes by knockout mutations can be time-consuming and inefficient, with the use of Tn-seq, one can screen the functionality of the majority of genes throughout the genome under different conditions. In this project, we aimed to construct a new transposon delivery system and a transposon insertion library of L. monocytogenes 10403S with full coverage that could be used to identify genes conditionally essential for survival under normal growth conditions and food-related conditions. To assemble a saturated Mariner transposon insertion library, we constructed a novel vector, pCG20, with controlled activation of transposition, which can be used in L. monocytogenes. However, after construction of a small-scale library, we found that homology of the region of the Prha promoter allowed for Campbell integration of the plasmid into the chromosome. The resulting mutant library likely contained a high percentage of cells without transposition and thus was not saturated enough for Tn-seq. These findings suggest that the Prahm region in pCG20 needs to be shortened to the minimum sequence region that allows rhamnose-dependent induction and limits Campbell integration.INTRODUCTIONL. monocytogenes is a ubiquitous bacterium in the environment and can persist and thrive under very different conditions. Its ability to grow in the presence of environmental stress challenges during food processing, and its transmission through food to humans, has made it a risk for food safety and public health. In the past decades, researchers have revealed that under specific environmental conditions (e.g. salt stress, cold temperature or intracellular growth) L. monocytogenes is able to modify its cell envelope composition (i.e. cell wall and membrane) in response to different stresses (Badaoui Najjar et al., 2007;Cabrita et al., 2015). These phenotypic changes could be linked to the fine-tuned differential expression of subsets of genes. While there are emerging data from transcriptomic and proteomic studies of L. monocytogenes under different conditions (Toledo-Arana et al., 2009;Schultze et al., 2015), functions of many genes involved in these studies remain unknown. To define potential targets for prevention and decrease the risk of L. monocytogenes infection, it is important to understand the functions of individual genes and to define the architecture of the complex networks of interacting genes.   To pool an array of single gene knockouts can be time-consuming and inefficient. With Tn-seq (Transposon insertion sequencing), identification of genetic interactions in L. monocytogenes quantitatively is possible through massively parallel sequencing. Tn-seq is a systemic tool based on the assembly of a saturated transposon insertion library (van Opijnen et al., 2009). After growth of the library under different conditions, frequencies of each gene insertion mutant are determined by sequencing. Changes in frequencies reflect the fitness of the mutation. The goals of this project were to develop a new transposon suitable for Tn-seq analyses and use it to construct a saturated Mariner transposon insertion library in Listeria monocytogenes. Furthermore, with Tn-seq we could identify conditionally essential genes in L. monocytogenes and important genes in stress response and virulence. We would grow this library under different conditions, including normal growth and stresses related to food processing (e.g. cold, antimicrobials stress). This approach could provide information of potential gene targets that could be utilized by the food industry to optimize and develop interventions against L. monocytogenes. MATERIALS AND METHODSVector Design and Construction A DNA fragment Tn-CG containing the Mariner transposon sequence with a rhamnose-inducible promoter was designed and synthesized (GenScript). This DNA fragment was digested by HindIII and KpnI, and subcloned into pKSV7 (Smith and Youngman, 1992), yielding the new plasmid pCG20. The plasmid construct was confirmed by restriction digestions of SacI and XbaI as well as sequencing. All the cloning steps were performed in E. coli NEB5? (NEB). Tn delivery system construction The final plasmid pCG20 was transformed into L. monocytogenes 10403S wild type strain through electroporation (yielding strain 10403S::pCG20; FSL B2-0446). A control strain (10403S::pKSV7) was constructed by introducing the empty plasmid pKSV7 into L. monocytogenes 10403S through electroporation. Electroporated cells were grown on a Brain Heart Infusion (BHI) agar plate with chloramphenicol at 30°C for 48 hours. Details will be discussed later in the results section.Transposon Library Construction Strains were streaked from frozen BHI glycerol stock onto a BHI agar plate with chloramphenicol, followed by incubation at 30°C for 24 h. A single colony of 10403S::pCG20 were picked, and each was grown to log phase in 5ml BHI culture with chloramphenicol and incubated at 30°C with shaking for 18 h. After incubation, 50 ?l of the culture was inoculated into fresh 5 ml BHI broth in a 10 ml tube and grown to OD600 0.4-0.5 at 37°C with shaking. Induction of the transposase was performed by adding 250 ?l of 1 M rhamnose stock solution to 5 ml OD600 0.4-0.5 bacterial cultures (for a final concentration of 50 mM rhamnose), followed by incubation at 37°C for an additional 30 min. The cultures were diluted 1:200 in PBS and 100?l of the dilution was plated on BHI agar plates with rhamnose and erythromycin. In total, 10 plates were collected and incubated at 41°C for 48 hours.  Colonies were harvested with a glass spreader and cells were stored in 15% glycerol aliquots at -80°C as the transposon insertion library sample. For selection in E. coli and L. monocytogenes, antibiotics were added at the following concentrations: ampicillin (100ug/ml), chloramphenicol (10ug/ml) and erythromycin (5ug/ml). Table 4.1 shows plasmids, primers, and strains used in this study.Table 4.1 Plasmids, Primers and Strains Used in This StudyPlasmids/Primers/StrainsDescriptionCommentPlasmidspKSV7(Smith and Youngman, 1992)pCG20pKSV7 with transposon element and PrhaStrainsL.monocytogenes 10403S wild type(Bishop and Hinrichs, 1987)L.monocytogenes 10403S::pCG20FSL B2-0446E. coli DH5alpha::pCG20FSL B2-0443E. coli DH5alpha::pKSV7FSL X1-0018PrimersYL76-int1FAAGTAATCCCACCGCAAAACTchromosome sequenceYL77-int1RCTGACAGCTTCCAAGGAGCTplasmid sequenceYL78-int2FTCCTCCGTGCTCATTTCACCplasmid sequenceYL79-int2RAGTGGTGCTTGATTGTGAGTTchromosome sequenceYL21-Adapter-1ATTCCCTACACGACGCTCTTCCGATCTTATAGCCTNNadapterYL22-Adapter-1BAGGCTATAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGadapterYL19-TnIR-SCAAGCAGAAGACGGCATACGAGTCTCGAGTGGGGTACGCGGGTCTamplification of libraryYL20-TnAdapter-PCRAATGATACGGCGACCACCGAGATCACACTCTTTCCCTACACGACGCTCTTCCamplification of libraryCG52GGAGCCATGTTTCATCCATTqPCR primer for transposaseCG53TCAAAGGAACGTGTTGGTCAqPCR primer for transposaseVGO-23-rpoB-RT-FTCGTCGTCTTCGTTCTGTTGqPCR primer for rpoBVGO-24-rpoB-RT-RGTTCGCCAAGTGGATTTGTTqPCR primer for rpoBSerial passaging for plasmid curing Passaging experiments were performed to test the thermo-sensitivity of the vectors pKSV7 and pCG20 as well as to cure pCG20 from the transposon insertion library. Briefly, 20 colonies were arbitrarily picked for each strain. Passaging was done by growing these colonies onto BHI plates at 41°C for 24h. After each passaging, single colonies were replica plated onto BHI, BHI with chloramphenicol, and BHI with erythromycin plate. The BHI plates were incubated at 41°C for 24h to continue the serial passaging, and the antibiotic plates were incubated at 30°C for 24h to test for plasmid curing and transposition. Detection of Campbell integration of pCG20 at Prham locus by PCR After three passages, transposon insertion library samples that were resistant to both chloramphenicol and erythromycin were tested for integration. Genomic DNA was isolated from each sample and used as templated DNA for PCR with primer sets of YL76 and YL77 as well as YL78 and YL79. PCR products were analyzed by gel electrophoresis in a 1.8% agarose gel.RESULTS AND DISCUSSION1. Construction of a novel L. monocytogenes transposon mutagenesis vectorDesign of the transposon element Tn-CG To obtain a vector for gene disruption, we designed a specific DNA blocks encoding functions important for transposition and selection. As shown in Figure 5.1, the 2021bp transposon insertion region carries (i) an erythromycin resistance gene for screening; (ii) an outward rhamnose-inducible promoter that controls expression of downstream mariner transposase to prevent early transposition events (Fieseler et al., 2012); and (iii) two inverted terminal repeat sequences (ITRs) . MmeI restriction sites were included within the ITRs for DNA library construction. SmaI restriction sites directly upstream and downstream of the transposon insertion region allowed specific digestion of retentive plasmid sequences in DNA libraries. Figure 5.1 Coding regions and restriction sites on transposon element Tn-CG. Restriction sites are labelled in blue, genes and promoters are shown in green rectangles. Inverse repeats (IR) and TA recognition sites are marked at the end of the transposon insertion region. A HindIII and a KpnI restriction site is located on the ends of Tn-CG. Genes and loci are not to scale. Cloning of Tn-CG to pKSV7 After Tn-CG was synthesized, it was digested with HindIII and KpnI, ligated with the integrational plasmid pKSV7, and transformed to E. coli DH5? to yield plasmid pCG20. The resulting construct pCG20 contains a temperature-sensitive replication origin derived from the pE194ts in Gram-positive bacteria (Smith and Youngman, 1992). The thermosensitive replication origin of pE194ts has been used to construct delivery vectors for obtaining chromosomal insertions of Tn917 and mariner transposon in L. monocytogenes (Camilli et al., 1990;Cao et al., 2007). pCG20 was digested with SacI and XbaI, and fragment size was verified. Sequencing results further confirmed the correct sequence for pCG20.Figure 5.2 Vector pCG20 carries a Himar1 Mariner transposon with an erythromycin resistance marker within Tn-CG region. The plasmid backbone harbors a temperature sensitive ori site (pE194ts), a chloramphenicol resistance marker functioning in Gram positive bacteria as well as an ampicillin resistance gene functioning in Gram negative bacteria.2. Evaluation of thermostability of pCG20 in comparison to pKSV7Containing the pE194ts origin, this new vector should display an extremely tight replication block above 37°C but remain essentially wild-type copy numbers at temperatures below 32°C as pKSV7 (Arnaud et al., 2004). Thermostability of pCG20 vs. the parental pKSV7 vector in L. monocytogenes was investigated by serial passaging in the absence of antibiotic selection at 41°C (non-permissive temperature). To ensure that bacteria were carrying the plasmid initially, twenty colonies were picked from colonies maintained in the presence of chloramphenicol (encoded by a gene on the plasmid backbone) and then grown on BHI at 41°C to allow plasmid loss to occur. After one to two serial passaging, all of the colonies that we tested (20/20) growing at 41°C had lost chloramphenicol resistance, indicating they had lost pCG20 or pKSV7. These data suggested that with the high loss rate at 41°C, the plasmid retention, in the free replicating form, would be relatively low in the transposon insertion library grown at 41°C.3. Verification of rhamnose-dependent expression of the transposase geneTo ensure activation of transposase under rhamnose induction, we examined a rhamnose dependent transcription induction of the gene encoding the transposase of pCG20 using qPCR at different rhamnose concentrations. Under 50mM rhamnose induction, a 2.4-fold increase of transcription of transposase gene was observed compared to the no rhamnose control. Figure 5.3 qRT-PCR results showed that under 50mM rhamnose induction, transposase was overexpressed. Relative expression was normalized to the housekeeping gene rpoB. One biological replicate was used and the error bars showed normalized error from experimental replicates.4. Small scale evaluation of transposition in L. monocytogenesTransposition efficiency To evaluate the transposition efficiency, we constructed a small-scale transposon insertion mutant library in L. monocytogenes. The 100?l 1:200 dilution of log phase culture plated on BHI agar plates with rhamnose and erythromycin yielded more than 1,500 colonies of various sizes per plate. This transposon library consisted of 10 plates and total colony number of this library was therefore more than 15,000. Plasmid curing at non-permissive temperature To further evaluate the randomness of transposition, we arbitrarily picked 20 colonies from the library and performed three serial passaging on BHI at 41°C. Cells with transposon insertion and without plasmids would only be erythromycin-resistant and chloramphenicol-sensitive. Twelve out of 20 were found to lose the plasmid without transposon insertion, as they were sensitive to both chloramphenicol and erythromycin. The remaining eight were resistant to both chloramphenicol and erythromycin, indicating that the plasmid backbone carrying the chloramphenicol resistance gene remained in these colonies under non-permissive temperature.  As the results of serial passaging of 10403S::pKSV7 and 10403S::pCG20 supported the thermo-sensitivity of the vector plasmid, this plasmid retention could possibly be explained by a single integration event of the plasmid through the homologous Prham region. Integration could happen through homologous region of plasmid and chromosomal DNA. Previous study reported that approximately 70bp homologous region was sufficient to initiate recombination between plasmid and chromosomal DNA in Bacillus and 100bp in Xylella (Khasanov et al., 1992;Kung et al., 2013). The current pCG20 construct contains a 652bp region that includes the rhamnose promoter Prha and the AraC-type DNA binding transcriptional regulator lmo2851. Since both Prha and lmo2851 are also present in L. monocytogenes 10403S genome (Fieseler et al., 2012), this homologous region could be responsible for Campbell integration when cells were grown at non-permissive temperature.Detection of Campbell integration via PCR. Campbell integration was identified by PCR. We designed PCR primers targeting at the two ends of the recombined DNA of plasmid and chromosomal DNA via the homologous sequences.  One of the primers binds to the pCG20 region and the other juxtaposes to the Prha region in the chromosome. DNA from all eight samples that were resistant to chloramphenicol and erythromycin were isolated and amplified. Figure 5.4 shows the resulting PCR products, confirming that all eight colonies had plasmid integrated into chromosome. Figure 5.4 PCR of Integration Sites in Genomic DNA of Passaged ColoniesTwo primer sets amplified both ends of the integration sites (homologous region of pCG20 and chromosome). For the primer set 1 (YL76 and YL77), the targeted amplicon size is 909 bp; and for the primer set 2 (YL78 and YL79), the targeted amplicon size is 1017 bp. The bands in the gel pictures were amplified from recombination of plasmid and chromosomal DNA, confirming that single integration event happened in all 8 samples. With the evidence of Campbell integration, the current pCG20 plasmid is not well suited for construction of a saturated transposon library in L. monocytogenes. However, the fact that the transposase was expressed under rhamnose induction suggests that this pCG20 construct still has the potential to be a backbone of a Tn-seq vector in L. monocytogenes. To prevent Campbell integration, the size of the homologous sequence should be reduced from 652bp to a considerably smaller size. As the next step, we would design and introduce different sized Prha promoter sequences into pCG20 to replace the current Prha sequence. Furthermore, transcription from the shortened Prha in L. monocytogenes would be confirmed by qPCR. Since L. monocytogenes contains around 3000 genes, the number of events required for saturation (95% chance that all the genes are hit) is about 30,000 (Phogat et al., 2001). With proper modification of pCG20, we could reduce the false positive rate and collect a transposon insertion library at large scale for Tn-seq.CONCLUSIONOur study is the first to build a mariner transposon library in Listeria specifically for Tn-seq. With the new vector pCG20, we were able to evaluate the quality of a transposon mutant library at a small scale, by confirming the transcription of the transposase under rhamnose induction using this vector. With plasmid curing experiments, we found that the plasmid sequence was not eliminated at non-permissive temperature. PCR results confirmed that a relatively high rate of Campbell integration of the whole plasmid into chromosome existed in our library. As Campbell integration is based on homologous recombination, to improve the quality of our library for Tn-seq, we will decrease the size of the homologous rhamnose promoter sequence in our vector. New Tn libraries will be collected using the modified vector and DNA libraries will be built and sent for high-throughput sequencing. Figure 5.5 shows the construction of Tn-seq DNA library from the bacteria mutant library.Figure 5.5 Tn-seq library sample preparation. Genomic DNA will be isolated from the library, and digested by MmeI that cuts 20bp from its restriction site and produces an overhang for adapter ligation. With a second digestion of SmaI, the DNA fragments of plasmid sequence will be digested and therefore not available for PCR amplification. The final library will contain the fragments amplified from 20bp of bacterial-specific DNA flanked by adapter sequences, which enable high-throughput sequencing.REFERENCEArnaud, M., Chastanet, A., and Debarbouille, M. (2004). New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol 70, 6887-6891.Badaoui Najjar, M., Chikindas, M., and Montville, T.J. (2007). Changes in Listeria monocytogenes membrane fluidity in response to temperature stress. Appl Environ Microbiol 73, 6429-6435.Bishop, D.K., and Hinrichs, D.J. (1987). Adoptive transfer of immunity to Listeria monocytogenes. The influence of in vitro stimulation on lymphocyte subset requirements. J Immunol 139, 2005-2009.Cabrita, P., Trigo, M.J., Ferreira, R.B., and Brito, L. (2015). Differences in the Expression of Cold Stress-Related Genes and in the Swarming Motility Among Persistent and Sporadic Strains of Listeria monocytogenes. Foodborne Pathog Dis 12, 576-584.Camilli, A., Portnoy, D.A., and Youngman, P. (1990). Insertional Mutagenesis of Listeria-Monocytogenes with a Novel Tn917 Derivative That Allows Direct Cloning of DNA Flanking Transposon Insertions. Journal of Bacteriology 172, 3738-3744.Cao, M., Bitar, A.P., and Marquis, H. (2007). A mariner-based transposition system for Listeria monocytogenes. Applied and Environmental Microbiology 73, 2758-2761.Fieseler, L., Schmitter, S., Teiserskas, J., and Loessner, M.J. (2012). Rhamnose-inducible gene expression in Listeria monocytogenes. PLoS One 7, e43444.Khasanov, F.K., Zvingila, D.J., Zainullin, A.A., Prozorov, A.A., and Bashkirov, V.I. (1992). Homologous Recombination between Plasmid and Chromosomal DNA in Bacillus-Subtilis Requires Approximately 70 Bp of Homology. Molecular & General Genetics 234, 494-497.Kung, S.H., Retchless, A.C., Kwan, J.Y., and Almeida, R.P. (2013). Effects of DNA size on transformation and recombination efficiencies in Xylella fastidiosa. Appl Environ Microbiol 79, 1712-1717.Phogat, S.K., Gupta, R., Burma, P.K., Sen, K., and Pental, D. (2001). On the estimation of number of events required for saturation mutagenesis of large genomes. Current Science 80, 823-824.Schultze, T., Hilker, R., Mannala, G.K., Gentil, K., Weigel, M., Farmani, N., Windhorst, A.C., Goesmann, A., Chakraborty, T., and Hain, T. (2015). A detailed view of the intracellular transcriptome of Listeria monocytogenes in murine macrophages using RNA-seq. Frontiers in Microbiology 6.Smith, K., and Youngman, P. (1992). Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74, 705-711.Toledo-Arana, A., Dussurget, O., Nikitas, G., Sesto, N., Guet-Revillet, H., Balestrino, D., Loh, E., Gripenland, J., Tiensuu, T., Vaitkevicius, K., Barthelemy, M., Vergassola, M., Nahori, M.A., Soubigou, G., Regnault, B., Coppee, J.Y., Lecuit, M., Johansson, J., and Cossart, P. (2009). The Listeria transcriptional landscape from saprophytism to virulence. Nature 459, 950-956.Van Opijnen, T., Bodi, K.L., and Camilli, A. (2009). Tn-seq: high-throughput parallel sequencing for fitness and genetic interaction studies in microorganisms. Nature Methods 6, 767.